Biology
Biology, 06.03.2020 12:58, oneicyahdaley10

This is a type of reproduction where one organism divides into two and there is no exchange of genetic informaiton

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 19:00, valeriegarcia12
Study this image. which statements best describe the rock shown? check all that apply. the grains of this rock are jagged. this rock has several coarse grains. the grains in this rock are very large. this rock has a non-banded pattern. the color of this rock is determined by its texture.
Answers: 2
image
Biology, 22.06.2019 00:30, loveagirl111puppy
On a recent expedition to a remote region of northern canada, scientists uncovered skeletal remains from about 100,000 years ago. surprisingly, all the skeletal remains, which included many species from differing biological families and spanned about two thousand years, showed evidence of experiencing temperatures in excess of 1000 degrees fahrenheit (or 538 degrees celsius). which of the following, if true, best explains the apparent paradox between the cold environment and the evidence of the bones experiencing hot temperatures? (a) chemical changes that naturally occur during the process of decay in only one north canadian species produce the same evidence of the species' skeletons being exposed to hot temperatures as the expedition scientists found. (b) a little over 103,000 years ago, a large fire is known to have occurred in northern canada. (c) strong evidence exists that as early as 70,000 years ago, homo sapiens around the world relied heavily on fire to cook animals. (d) in the same expedition and in roughly the same layer of excavation, scientists found rudimentary wood cutting and hunting tools used by early humans.
Answers: 3
image
Biology, 22.06.2019 09:10, kaciebrin211
Hormones are chemical molecules produced by endocrine glands. one such endocrine gland is the thyroid gland, which synthesizes the thyroid hormone, which in turn affects the heart muscles. which two statements describe the probable reason for the function of the hormone? the cells in the heart have specific receptors that allow for the intake of hormones. the heart and the endocrine glands have the exact same types of cells. all cells make the same types of hormones. thyroid hormones show their effect on the heart by means of specialized cells. thyroid cells and cardiac cells have different dna.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
This is a type of reproduction where one organism divides into two and there is no exchange of genet...

Questions in other subjects:

Konu
Mathematics, 16.09.2020 18:01
Konu
Mathematics, 16.09.2020 18:01
Konu
Mathematics, 16.09.2020 18:01
Konu
Mathematics, 16.09.2020 18:01
Konu
Mathematics, 16.09.2020 18:01
Konu
Mathematics, 16.09.2020 18:01
Konu
Mathematics, 16.09.2020 18:01
Konu
Chemistry, 16.09.2020 18:01
Konu
Mathematics, 16.09.2020 18:01
Konu
Mathematics, 16.09.2020 18:01